circad | circRNAs associated with diseases

hsa_circ_0006174
Gene	RAD23B	Organism	Human
Genome Locus	chr9:110064315-110068928:+	Build	hg19
Disease	Colorectal Cancer	ICD-10	Malignant neoplasm of rectosigmoid junction (C19)
DBLink	Link to database	PMID	28656150
Experimental Method
Sample Type	HCT116 Cell line	Comparison	HCT116 cell lines and Chemoradiation Resistant HCT116 cells
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CATCCATCACTCCAGCATCAG Reverse GGTCACCATAACCACCACAAAG	Statistics	Fold Change : Downregulated,2.7 pvalue : p=5.28E − 04
Citation
Xiong, W, Ai, YQ, Li, YF, Ye, Q, Chen, ZT, Qin, JY, Liu, QY, Wang, H, Ju, YH, Li, WH, Li, YF (2017). Microarray Analysis of Circular RNA Expression Profile Associated with 5-Fluorouracil-Based Chemoradiation Resistance in Colorectal Cancer Cells. Biomed Res Int, 2017:8421614.